Site Search by Google

Resources

Libraries
Human "32k" BAC Re-Array
GENSAT Collection
Vectors
Filters
Filter Interpreter Application
Mapped Clones
Non-Recombinants


Procedures
Online Mapping Resources
Download Page
Questions and Answers

Research

BAC Library Construction
ALS
Publications

 
 Resources 
 Vector pBACGK1.1 Information/Map    

 

The pBACGK1.1 vector was constructed by Kazutoyo Osoegawa at the Children's Hospital Oakland Research Institute, in the Pieter J. de Jong's laboratory. The vector is derived from the pBACe3.6 vector by inserting attB1 and attB2 sites and deleting loxP and lox511 sites. These attachment sites were introduced to facilitate the transfer of insert DNA into other vectors system by the GATEWAY (Invitrogen-TM) system. The vector still maintains many features from the pBACe3.6 vector, including: positive selection for insert DNA on sucrose plates using the SacB gene, chloramphenicol resistance, multiple cloning sites, T7 and SP6 promoter sequences, two Not1 restriction sites immediately flanking the eventual insert and a homing enzyme site (PI-SceI). The sequences of the attB1 and attB2 sites are: ACAAGTTTGTACAAAAAAGCAGGCT and ACCCAGCTTTCTTGTACAAAGTGGT (inserted in this orientation in the vector with the 5'nucleotide termini reflecting the lowest vector position numbers). The attB1 and attB2 sites are localized at positions of 11105-11129 and 2855-2879 in the vector.


Contact BACPAC Resources ( BACPACorders@chori.org ) for further information regarding current availability or ordering.

For questions related to the site, please contact webmaster.
The use of this website is subject to the terms of use.